A FASTQ file normally uses four lines per sequence.
- Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line).
- Line 2 is the raw sequence letters.
- Line 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again.
- Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
A FASTQ file containing a single sequence might look like this:
@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
The character '!' represents the lowest quality while '~' is the highest. Here are the quality value characters in left-to-right increasing order of quality (ASCII):
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "@" and "+" as markers (these characters can also occur in the quality string).
No comments:
Post a Comment